Clinical and Molecular Insights into Gastrointestinal Dysfunction in Myotonic Dystrophy Types 1 & 2.

Myotonic dystrophy (DM) is a highly variable, multisystemic disorder that clinically affects one in 8000 individuals. While research has predominantly focused on the symptoms and pathological mechanisms affecting striated muscle and brain, DM patient surveys have identified a high prevalence for gastrointestinal (GI) symptoms amongst affected individuals. Clinical studies have identified chronic and progressive dysfunction of the esophagus, stomach, liver and gallbladder, small and large intestine, and rectum and anal sphincters. Despite the high incidence of GI dysmotility in DM, little is known regarding the pathological mechanisms leading to GI dysfunction. In this review, we summarize results from clinical and molecular analyses of GI dysfunction in both genetic forms of DM, DM type 1 (DM1) and DM type 2 (DM2). Based on current knowledge of DM primary pathological mechanisms in other affected tissues and GI tissue studies, we suggest that misregulation of alternative splicing in smooth muscle resulting from the dysregulation of RNA binding proteins muscleblind-like and CUGBP-elav-like is likely to contribute to GI dysfunction in DM. We propose that a combinatorial approach using clinical and molecular analysis of DM GI tissues and model organisms that recapitulate DM GI manifestations will provide important insight into defects impacting DM GI motility.

Increased α-tocopherol metabolism in horses with equine neuroaxonal dystrophy.

BACKGROUND: Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder associated with a vitamin E deficiency within the first year of life. Vitamin E consists of 8 isoforms metabolized by the CYP4F2 enzyme. No antemortem diagnostic test currently exists for eNAD/EDM. HYPOTHESIS/OBJECTIVES: Based on the association of α-tocopherol deficiency with the development of eNAD/EDM, we hypothesized that the rate of α-tocopherol, but not γ-tocopherol or tocotrienol metabolism, would be increased in eNAD/EDM-affected horses. ANIMALS: Vitamin E metabolism: Proof of concept (POC) study; eNAD/EDM-affected (n = 5) and control (n = 6) horses. Validation study: eNAD/EDM-affected Quarter Horses (QHs; n = 6), cervical vertebral compressive myelopathy affected (n = 6) horses and control (n = 29) horses. CYP4F2 expression and copy number: eNAD/EDM-affected (n = 12) and age- and sex-matched control (n = 11-12) horses. METHODS: The rates of α-tocopherol/tocotrienol and γ-tocopherol/tocotrienol metabolism were assessed in equine serum (POC and validation) and urine (POC only) using liquid chromatography tandem mass spectrometry (LC-MS/MS). Quantitative reverse-transcriptase PCR (qRT-PCR) and droplet digital (dd)-PCR were used to assay expression and genomic copy number of a CYP4F2 equine ortholog. RESULTS: Metabolic rate of α-tocopherol was increased in eNAD/EDM horses (POC,P < .0001; validation, P = .03), with no difference in the metabolic rate of γ-tocopherol. Horses with eNAD/EDM had increased expression of the CYP4F2 equine orthologue (P = .02) but no differences in copy number. CONCLUSIONS AND CLINICAL IMPORTANCE: Increased α-tocopherol metabolism in eNAD/EDM-affected QHs provides novel insight into alterations in vitamin E processing in eNAD/EDM and highlights the need for high-dose supplementation to prevent the clinical phenotype in genetically susceptible horses.

A nonsense variant in Rap Guanine Nucleotide Exchange Factor 5 (RAPGEF5) is associated with equine familial isolated hypoparathyroidism in Thoroughbred foals.

Idiopathic hypocalcemia in Thoroughbred (TB) foals causes tetany and seizures and is invariably fatal. Based upon the similarity of this disease with human familial hypoparathyroidism and occurrence only in the TB breed, we conducted a genetic investigation on two affected TB foals. Familial hypoparathyroidism was identified, and pedigree analysis suggested an autosomal recessive (AR) mode of inheritance. We performed whole-genome sequencing of the two foals, their unaffected dams and four unaffected, unrelated TB horses. Both homozygosity mapping and an association analysis were used to prioritize potential genetic variants. Of the 2,808 variants that significantly associated with the phenotype using an AR mode of inheritance (P<0.02) and located within a region of homozygosity, 1,507 (54%) were located in a 9.7 Mb region on chr4 (44.9-54.6 Mb). Within this region, a nonsense variant (RAPGEF5 c.2624C>A,p.Ser875*) was significantly associated with the hypoparathyroid phenotype (Pallelic = 0.008). Affected foals were homozygous for the variant, with two additional affected foals subsequently confirmed in 2019. Necropsies of all affected foals failed to identify any histologically normal parathyroid glands. Because the nonsense mutation in RAPGEF5 was near the C-terminal end of the protein, the impact on protein function was unclear. Therefore, we tested the variant in our Xenopus overexpression model and demonstrated RAPGEF5 loss-of-function. This RAPGEF5 variant represents the first genetic variant for hypoparathyroidism identified in any domestic animal species.

Genome-Wide Association Study and Subsequent Exclusion of ATCAY as a Candidate Gene Involved in Equine Neuroaxonal Dystrophy Using Two Animal Models.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype (p = 2.05 × 10-7 and 4.72 × 10-6). Within this region, caytaxin (ATCAY) was identified as a candidate gene due to its known role in Cayman Ataxia and ataxic/dystonic phenotypes in mouse models. Whole-genome sequence data in four eNAD/EDM and five unaffected horses identified 199 associated variants within the ECA7 region. MassARRAY® genotyping was performed on these variants within the GWAS population. The three variants within ATCAY were not concordant with the disease phenotype. No difference in expression or alternative splicing was identified using qRT-PCR in brainstem across the ATCAY transcript. Atcayji-hes mice were then used to conduct functional analysis in a second animal model. Histologic lesions were not identified in the central nervous system of Atcayji-hes mice. Additionally, supplementation of homozygous Atcayji-hes mice with 600 IU/day of dl-α-tocopheryl acetate (vitE) during gestation, lactation, and adulthood did not improve the phenotype. ATCAY has therefore been excluded as a candidate gene for eNAD/EDM.

Single-Cell RNA-seq Reveals Profound Alterations in Mechanosensitive Dorsal Root Ganglion Neurons with Vitamin E Deficiency.

Ninety percent of Americans consume less than the estimated average requirements of dietary vitamin E (vitE). Severe vitE deficiency due to genetic mutations in the tocopherol transfer protein (TTPA) in humans results in ataxia with vitE deficiency (AVED), with proprioceptive deficits and somatosensory degeneration arising from dorsal root ganglia neurons (DRGNs). Single-cell RNA-sequencing of DRGNs was performed in Ttpa-/- mice, an established model of AVED. In stark contrast to expected changes in proprioceptive neurons, Ttpa-/- DRGNs showed marked upregulation of voltage-gated Ca2+ and K+ channels in mechanosensitive, tyrosine-hydroxylase positive (TH+) DRGNs. The ensuing significant conductance changes resulted in reduced excitability in mechanosensitive Ttpa-/- DRGNs. A highly supplemented vitE diet (600 mg dl-α-tocopheryl acetate/kg diet) prevented the cellular and molecular alterations and improved mechanosensation. VitE deficiency profoundly alters the molecular signature and functional properties of mechanosensitive TH+ DRGN, representing an intriguing shift of the prevailing paradigm from proprioception to mechanical sensation.

Impact of alpha-tocopherol deficiency and supplementation on sacrocaudalis and gluteal muscle fiber histopathology and morphology in horses.

BACKGROUND: A subset of horses deficient in alpha-tocopherol (α-TP) develop muscle atrophy and vitamin E-responsive myopathy (VEM) characterized by mitochondrial alterations in the sacrocaudalis dorsalis medialis muscle (SC). OBJECTIVES: To quantify muscle histopathologic abnormalities in subclinical α-TP deficient horses before and after α-TP supplementation and compare with retrospective (r)VEM cases. ANIMALS: Prospective study; 16 healthy α-TP-deficient Quarter Horses. Retrospective study; 10 retrospective vitamin E-responsive myopathy (rVEM) cases . METHODS: Blood, SC, and gluteus medius (GM) biopsy specimens were obtained before (day 0) and 56 days after 5000 IU/450 kg horse/day PO water dispersible liquid α-TP (n = 8) or control (n = 8). Muscle fiber morphology and mitochondrial alterations were compared in samples from days 0 and 56 and in rVEM cases. RESULTS: Mitochondrial alterations more common than our reference range (<2.5% affected fibers) were present in 3/8 control and 4/8 treatment horses on day 0 in SC but not in GM (mean, 2.2; range, 0%-10% of fibers). Supplementation with α-TP for 56 days did not change the percentage of fibers with mitochondrial alterations or anguloid atrophy, or fiber size in GM or SC. Clinical rVEM horses had significantly more mitochondrial alterations (rVEM SC, 13% ± 7%; GM, 3% ± 2%) and anguloid atrophy compared to subclinical day 0 horses. CONCLUSIONS AND CLINICAL IMPORTANCE: Clinically normal α-TP-deficient horses can have mitochondrial alterations in the SC that are less severe than in atrophied VEM cases and do not resolve after 56 days of α-TP supplementation. Preventing α-TP deficiency may be of long-term importance for mitochondrial viability.

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed.

Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds.

Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nucleotide polymorphisms (SNPs) in the genomic region, was carried out on 31 postmortem-confirmed eNAD/EDM cases and 43 clinically phenotyped controls from various breeds. No significant association was found between eNAD/EDM confirmed cases and genotype at any of the four identified SNPs (P > 0.05), including the nonsynonymous variant (EquCab2.0 chr3:71,917,591; allelic P = 0.85). These findings suggest that the four SNPs, including the missense variant in the ADGRL3 region, are not associated with risk for eNAD/EDM across multiple breeds of horses.